After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Canin Angiopoietin-2/ANG2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Canine ANGPT2 Informations sur les produits clonés de cDNA
Taille du ADNc:1488bp
Description du ADNc:Full length Clone DNA of Canis lupus familiaris angiopoietin 2 with C terminal Flag tag.
Synonyme du gène:ANG-2, ANGPT2
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in angiogenesis during the development and growth of human cancers. Both ANGPT-1 and ANGPT-2 appear to bind to the tyrosine kinase receptor, Tie-2, found primarily on the luminal surface of endothelial cells. ANG-2's role in angiogenesis generally is considered as an antagonist for ANG1, inhibiting ANG1-promoted Tie2 signaling, which is critical for blood vessel maturation and stabilization. ANG-2 modulates angiogenesis in a cooperative manner with another important angiogenic factor, vascular endothelial growth factor A. Genetic studies have revealed that ANG-2 also is critical in lymphangiogenesis during development. ANG-2 has multiple physiologic effects that regulate vascular tone, hormone secretion, tissue growth and neural activity. Several reports indicate that ANG-2 can induce neovascularization in experimental systems due to the expression of different growth factors such as angiopoietin 2, vascular endothelial factor, and its receptor, fibroblast growth factor, platelet derived growth factor, transforming growth factor beta and epidermal growth factor. In addition, ANG-2 is strongly expressed in the vasculature of many tumors and it has been suggested that ANG-2 may act synergistically with other cytokines such as vascular endothelial growth factor to promote tumor-associated Angiogenesis and tumor progression.

  • Thomas M, et al. (2009) The role of the Angiopoietins in vascular morphogenesis. Angiogenesis. 12(2): 125-37.
  • Hu B, et al. (2009) Angiopoietin-2: development of inhibitors for cancer therapy. Curr Oncol Rep. 11(2): 111-6.
  • Fiedler U, et al. (2006) Angiopoietins: a link between angiogenesis and inflammation. Trends Immunol. 27: 552-8.
  • Escobar E, et al. (2004) Angiotensin II, cell proliferation and angiogenesis regulator: biologic and therapeutic implications in cancer. Curr Vasc Pharmacol. 2(4): 385-99.
  • Size / Price
    Catalogue : DG70034-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.