After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Canin CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Canine CHN1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_845334.3
Taille du ADNc:1005bp
Description du ADNc:Full length Clone DNA of Canis lupus familiaris chimerin 1 with C terminal His tag.
Synonyme du gène:CHN1
Espèces:Canine
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canin CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Product nameProduct name
Fond

CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

Références
  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • Size / Price
    Catalogue : DG70211-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »