After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Canine DPYS Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_003639441.1
Taille du ADNc:1557bp
Description du ADNc:Full length Clone DNA of Canis lupus familiaris dihydropyrimidinase-like with C terminal Flag tag.
Synonyme du gène:DPYS
Espèces:Canine
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurDG70036-ACGCHF290
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurDG70036-ACRCHF290
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurDG70036-ANGCHF290
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurDG70036-ANRCHF290
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurDG70036-CFCHF260
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurDG70036-CHCHF260
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurDG70036-CMCHF260
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurDG70036-CYCHF260
Canin DPYS / Dihydropyrimidinase Gène ADNc clone le vecteur de clonageDG70036-GCHF90
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurDG70036-NFCHF260
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurDG70036-NHCHF260
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurDG70036-NMCHF260
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurDG70036-NYCHF260
Canin DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF cloneDG70036-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

Références
  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
  • Size / Price
    Catalogue : DG70036-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »