Commande rapide

Canin GATE-16 / GABARAPL2 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Canine GABARAPL2 Informations sur les produits clonés de cDNA
Taille du ADNc:354bp
Description du ADNc:Full length Clone DNA of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 with C terminal His tag.
Synonyme du gène:GABARAPL2
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canin GATE-16 / GABARAPL2 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Product nameProduct name

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Catalogue : DG70191-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.