IL13RA2 cDNA ORF Clone, Canine, C-Myc tag

Price:
Size:
Number:

IL13RA2 cDNA ORF Clone, Canine, C-Myc tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1161 bp
Description
Full length Clone DNA of Canine interleukin 13 receptor, alpha 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL13RA2 Background Information

Interleukin-13 receptor subunit alpha-2 (IL13RA2/IL-13RA2) is also known as also known as cluster of differentiation 213A2 (CD213A2), IL-13 receptor subunit alpha-2, IL-13R subunit alpha-2, and IL-13RA2. The IL13RA2 is often overexpressed in brain tumors, making Il13ra2 one of the vaccine targets for immunotherapy of glioma. IL13RA2/IL-13RA2 is a cancer-associated receptor that is present in greater than 8% of High Grade Astrocytomas (HGA) and has recently been recognized as a cytokine that predisposes breast cancer cells to metastasize. Expression of IL13Rα2 was rapidly lost from the surface of transduced cells grown in culture. The loss appeared to be related to ligands present in fetal bovine serum in the medium. None of the malignant glioma cell lines cultivated in vitro and tested to date exhibited the IL13Rα2 receptor. A recombinant virus (R5111) enters cells via its interaction with the IL13Rα2 receptor in a manner that cannot be differentiated from the interaction of wild-type virus with its receptors.
Full Name
interleukin 13 receptor, alpha 2
References
  • Zhou G, et al.. (2005) Characterization of a recombinant herpes simplex virus 1 designed to enter cells via the IL13Ralpha2 receptor of malignant glioma cells. J Virol. 79(9): 5272-7.
  • Osawa M, et al.. (2000) Characterization of the mouse interleukin-13 receptor alpha1 gene. Immunogenetics. 51(11): 974-81.
  • Nair BG, et al.. (2011) Nanotechnology platforms; an innovative approach to brain tumor therapy. Med Chem. 7(5): 488-503.
  • Benson M, et al.. (2006) A network-based analysis of the late-phase reaction of the skin. J Allergy Clin Immunol. 118(1): 220-5.

IL13RA2 cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed