LDHB cDNA ORF Clone, Canine, C-His tag

Cat: DG70190-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All LDHB Reagents

CRO Services

Product recommended


All LDHB Reagents

LDHB cDNA ORF Clone, Canine, C-His tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Canine lactate dehydrogenase B with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LDHB Background Information

Full Name
lactate dehydrogenase B

LDHB cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
LDHB cDNA ORF Clone in Cloning Vector, Canine DG70190-U
LDHB cDNA ORF Clone, Canine, untagged DG70190-UT
LDHB Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70190-ACGLN
LDHB cDNA ORF Clone, Canine, C-GFPSpark® tag DG70190-ACG
LDHB cDNA ORF Clone, Canine, N-GFPSpark® tag DG70190-ANG
LDHB cDNA ORF Clone, Canine, C-OFPSpark® tag DG70190-ACR
LDHB cDNA ORF Clone, Canine, N-OFPSpark® tag DG70190-ANR
LDHB cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70190-CF
LDHB cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70190-NF
LDHB cDNA ORF Clone, Canine, N-His tag DG70190-NH
LDHB cDNA ORF Clone, Canine, C-HA tag DG70190-CY
LDHB cDNA ORF Clone, Canine, N-HA tag DG70190-NY
LDHB cDNA ORF Clone, Canine, C-Myc tag DG70190-CM
LDHB cDNA ORF Clone, Canine, N-Myc tag DG70190-NM

LDHB cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
LDHB cDNA ORF Clone in Cloning Vector, Rhesus CG90336-G
LDHB cDNA ORF Clone, Rhesus, untagged CG90336-UT
LDHB cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90336-ACG
LDHB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90336-ACGLN
LDHB cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90336-ANG
LDHB cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90336-ACR
LDHB cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90336-ANR
LDHB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90336-CF
LDHB cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90336-NF
LDHB cDNA ORF Clone, Rhesus, C-His tag CG90336-CH
LDHB cDNA ORF Clone, Rhesus, N-His tag CG90336-NH
LDHB cDNA ORF Clone, Rhesus, C-HA tag CG90336-CY
LDHB cDNA ORF Clone, Rhesus, N-HA tag CG90336-NY
LDHB cDNA ORF Clone, Rhesus, C-Myc tag CG90336-CM
LDHB cDNA ORF Clone, Rhesus, N-Myc tag CG90336-NM

LDHB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LDHB cDNA ORF Clone in Cloning Vector, Rat RG81308-U
LDHB cDNA ORF Clone, Rat, untagged RG81308-UT
LDHB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81308-ACGLN
LDHB cDNA ORF Clone, Rat, C-GFPSpark® tag RG81308-ACG
LDHB cDNA ORF Clone, Rat, N-GFPSpark® tag RG81308-ANG
LDHB cDNA ORF Clone, Rat, C-OFPSpark® tag RG81308-ACR
LDHB cDNA ORF Clone, Rat, N-OFPSpark® tag RG81308-ANR
LDHB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81308-CF
LDHB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81308-NF
LDHB cDNA ORF Clone, Rat, C-His tag RG81308-CH
LDHB cDNA ORF Clone, Rat, N-His tag RG81308-NH
LDHB cDNA ORF Clone, Rat, C-HA tag RG81308-CY
LDHB cDNA ORF Clone, Rat, N-HA tag RG81308-NY
LDHB cDNA ORF Clone, Rat, C-Myc tag RG81308-CM
LDHB cDNA ORF Clone, Rat, N-Myc tag RG81308-NM
LDHB qPCR Primer Pairs, Rat RP301264

LDHB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LDHB cDNA ORF Clone in Cloning Vector, Mouse MG51735-G
LDHB cDNA ORF Clone, Mouse, untagged MG51735-UT
LDHB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51735-ACGLN
LDHB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51735-ACG
LDHB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51735-ANG
LDHB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51735-ACR
LDHB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51735-ANR
LDHB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51735-CF
LDHB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51735-NF
LDHB cDNA ORF Clone, Mouse, C-His tag MG51735-CH
LDHB cDNA ORF Clone, Mouse, N-His tag MG51735-NH
LDHB cDNA ORF Clone, Mouse, C-HA tag MG51735-CY
LDHB cDNA ORF Clone, Mouse, N-HA tag MG51735-NY
LDHB cDNA ORF Clone, Mouse, C-Myc tag MG51735-CM
LDHB cDNA ORF Clone, Mouse, N-Myc tag MG51735-NM
LDHB qPCR Primer Pairs, Mouse MP201608

LDHB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LDHB cDNA ORF Clone in Cloning Vector, Human HG16191-G
LDHB cDNA ORF Clone, Human, untagged HG16191-UT
LDHB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16191-ACGLN
LDHB cDNA ORF Clone, Human, C-GFPSpark® tag HG16191-ACG
LDHB cDNA ORF Clone, Human, N-GFPSpark® tag HG16191-ANG
LDHB cDNA ORF Clone, Human, C-OFPSpark® tag HG16191-ACR
LDHB cDNA ORF Clone, Human, N-OFPSpark® tag HG16191-ANR
LDHB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16191-CF
LDHB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16191-NF
LDHB cDNA ORF Clone, Human, C-His tag HG16191-CH
LDHB cDNA ORF Clone, Human, N-His tag HG16191-NH
LDHB cDNA ORF Clone, Human, C-HA tag HG16191-CY
LDHB cDNA ORF Clone, Human, N-HA tag HG16191-NY
LDHB cDNA ORF Clone, Human, C-Myc tag HG16191-CM
LDHB cDNA ORF Clone, Human, N-Myc tag HG16191-NM
LDHB qPCR Primer Pairs, Human HP104959
info info
添加购物车成功! 添加购物车失败!