Commande rapide

Canin LC3B / MAP1LC3B expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Canin MAP1LC3B Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_536756.4
Taille du ADNc:378bp
Description du ADNc:Full length Clone DNA of Canis lupus familiaris microtubule-associated protein 1 light chain 3 beta with C terminal His tag.
Synonyme du gène:MAP1LC3B
Espèces:Canine
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Canin LC3B / MAP1LC3B expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Product nameProduct name
Fond

LC3B, also known as MAP1LC3B, is a member of the MAP1 LC3 family. It is moat abundantly expressed in heart, brain, skeletal muscle and testis. LC3B is a subunit of neuronal microtubule and functions in formation of autophagosomal vacuoles (autophagosomes). It associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. LC3B also plays a role in autophagy, a process that involves the bulk degradation of cytoplasmic component.

Références
  • Behrends C. et al., 2010, Nature. 466 (7302): 68-76.
  • Tanida I. et al., 2005, Int J Biochem Cell Biol. 36 (12): 2503-18.
  • Kabeya Y. et al., 2000, EMBO J. 19 (21): 5720-8.
  • Cherra SJ. et al., 2010, J Cell Biol. 190 (4): 533-9.
  • Size / Price
    Catalogue : DG70200-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »