Commande rapide

Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Canine MUT Informations sur les produits clonés de cDNA
Taille du ADNc:450bp
Description du ADNc:Full length Clone DNA of Canis lupus familiaris methylmalonyl CoA mutase with C terminal HA tag.
Synonyme du gène:MUT
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurDG70241-ACGCHF270
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurDG70241-ACRCHF270
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurDG70241-ANGCHF270
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurDG70241-ANRCHF270
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurDG70241-CFCHF230
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurDG70241-CHCHF230
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurDG70241-CMCHF230
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurDG70241-CYCHF230
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurDG70241-NFCHF230
Canin calmodulin 3/CALM3 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurDG70241-NHCHF230
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurDG70241-NMCHF230
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurDG70241-NYCHF230
Canin MUT/Methylmalonyl CoA mutase Gène ADNc clone le vecteur de clonageDG70241-UCHF90
Canin MUT/Methylmalonyl CoA mutase expression plasmide de Gène l'ADNc ORF cloneDG70241-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.