Commande rapide

Rhesus ACO2 ORF mammalian expression plasmid, N-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus ACO2 Informations sur les produits clonés de cDNA
Taille du ADNc:2343bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) aconitase 2, mitochondrial with N terminal His tag.
Synonyme du gène:ACO2
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins. 5 (4): 289-312.
  • Lauble H, et al. (1992) Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry. 31 (10): 2735-48.
  • Robbins AH, et al. (1989) Structure of activated aconitase: formation of the 4Fe-4S cluster in the crystal. Proc Natl Acad Sci. 86 (10): 3639-43.
  • Size / Price
    Catalogue : CG90615-NH
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.