After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus ACTL6B Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_005549245.1
Taille du ADNc:1281bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) actin-like 6B with N terminal His tag.
Synonyme du gène:ACTL6B
Espèces:Cynomolgus
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90607-ACGCHF270
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90607-ACRCHF270
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90607-ANGCHF270
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90607-ANRCHF270
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90607-CFCHF230
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90607-CHCHF230
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90607-CMCHF230
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90607-CYCHF230
Macaque de Buffon Actin-like Protéine 6B/BAF53b Gène ADNc clone le vecteur de clonageCG90607-GCHF90
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90607-NFCHF230
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90607-NHCHF230
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90607-NMCHF230
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90607-NYCHF230
Macaque de Buffon Actin-like Protéine 6B/BAF53b expression plasmide de Gène l'ADNc ORF cloneCG90607-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90607-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »