Commande rapide

Rhesus ALK-2/ACVR1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus ACVR1 Informations sur les produits clonés de cDNA
Taille du ADNc:1530bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) activin A receptor, type I with C terminal Myc tag.
Synonyme du gène:ACVR1
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its ability to bind activin in concert with ActRII or ActRIIB. ALK-2 is also identified as a BMP type I receptor. It has been demonstrated that ALK-2 forms complex with either the BMP-2/7-bound BMPR-II or ACVR2A /ACVR2B. ALK-1 and ALK-2 presenting in the yeast Saccharomyces cerevisiae are two haspin homologues. Both ALK-1 and ALK-2 exhibit a weak auto-kinase activity in vitro, and are phosphoproteins in vivo. ALK-1 and ALK-2 levels peak in mitosis and late-S/G2. Control of protein stability plays a major role in ALK-2 regulation. The half-life of ALK-2 is particularly short in G1. Overexpression of ALK-2, but not of ALK-1, causes a mitotic arrest, which is correlated to the kinase activity of the protein. This suggests a role for ALK-2 in the control of mitosis. Endoglin is phosphorylated on cytosolic domain threonine residues by the TGF-beta type I receptors ALK-2 and ALK-5 in prostate cancer cells. Endoglin did not inhibit cell migration in the presence of constitutively active ALK-2. Defects in ALK-2 are a cause of fibrodysplasia ossificans progressiva (FOP).

  • Armes NA,et al. (1997) The ALK-2 and ALK-4 activin receptors transduce distinct mesoderm-inducing signals during early Xenopus development but do not co-operate to establish thresholds. Development 124(19): 3797-804.
  • Armes NA, et al. (1999) A short loop on the ALK-2 and ALK-4 activin receptors regulates signaling specificity but cannot account for all their effects on early Xenopus development. J Biol Chem. 274(12):7929-35.
  • Kawai S, et al. (2000) Mouse smad8 phosphorylation downstream of BMP receptors ALK-2, ALK-3, and ALK-6 induces its association with Smad4 and transcriptional activity.Biochem Biophys Res Commun. 271(3):682-7.
  • Deng Y, et al. (2009) Efficient highly selective synthesis of methyl 2-(ethynyl)alk-2(E)-enoates and 2-(1'-chlorovinyl)alk-2(Z)-enoates from 2-(methoxycarbonyl)-2,3-allenols. Organic letters 11(10):2169-72.
  • Size / Price
    Catalogue : CG90058-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.