Commande rapide

Text Size:AAA

Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus AGPAT4 Informations sur les produits clonés de cDNA
Taille du ADNc:1137bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) 1-acyl-sn-glycerol-3-phosphate acyltransferase delta with N terminal Myc tag.
Synonyme du gène:AGPAT4
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90655-ACGCHF270
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90655-ACRCHF270
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90655-CFCHF230
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90655-CHCHF230
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90655-CMCHF230
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90655-CYCHF230
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 Gène ADNc clone le vecteur de clonageCG90655-GCHF90
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90655-NFCHF230
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90655-NHCHF230
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90655-NMCHF230
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90655-NYCHF230
Macaque de Buffon 1-AGP acyltransferase 4/AGPAT4 expression plasmide de Gène l'ADNc ORF cloneCG90655-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90655-NM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.