Commande rapide

Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon ARF3 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:XM_005570735.1
    Taille du ADNc:546bp
    Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosylation factor 3.
    Synonyme du gène:ARF3
    Espèces:Cynomolgus
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone on other vectors
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90751-ACGCHF270
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90751-ACRCHF270
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90751-CFCHF230
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90751-CHCHF230
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90751-CMCHF230
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90751-CYCHF230
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 Gène ADNc clone le vecteur de clonageCG90751-GCHF90
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90751-NFCHF230
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90751-NHCHF230
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90751-NMCHF230
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90751-NYCHF230
    Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF cloneCG90751-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

    Références
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • Size / Price
    Catalogue : CG90751-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »