After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus ARF3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_005570735.1
Taille du ADNc:546bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosylation factor 3.
Synonyme du gène:ARF3
Espèces:Cynomolgus
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone on other vectors
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90751-ACGCHF270
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90751-ACRCHF270
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90751-CFCHF234
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90751-CHCHF234
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90751-CMCHF234
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90751-CYCHF234
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 Gène ADNc clone le vecteur de clonageCG90751-GCHF90
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90751-NFCHF234
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90751-NHCHF234
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90751-NMCHF234
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90751-NYCHF234
Macaque de Buffon ARF3 / ADP-ribosylation factor 3 expression plasmide de Gène l'ADNc ORF cloneCG90751-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

Références
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • Size / Price
    Catalogue : CG90751-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »