BMP10 cDNA ORF Clone, Rhesus, C-HA tag

Price:
Size:
Number:

BMP10 cDNA ORF Clone, Rhesus, C-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Rhesus bone morphogenetic protein 10 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BMP10 Background Information

Bone morphogenetic proteins (BMPs) control the development of diverse tissues during embryogenesis. Bone morphogenetic protein-1 (BMP1), a novel member of the bone morphogenetic protein (BMP) family, has been indicated as a possible tumour suppressor in prostate and breast cancer. Hypertension induced expression of prohypertrophic BMP1, and the hypertrophic effect of BMP1 was modulated, at least in part, by its binding to Tcap at the Z disc. Expression of BMP1 protein is reduced in cancer cells of bladder tumours. Overexpression of BMP1 has an inhibitory effect on the growth, adhesion, and migration of bladder cancer cells in vitro. This would suggest a potential tumour suppressor role of BMP1 in bladder cancer. Bone morphogenetic protein (BMP)9 and BMP1 are high affinity ligands for activin receptor-like kinase 1 (ALK1), a type I BMP receptor mainly expressed on vascular endothelial cells (ECs). ALK1-mediated BMP9/BMP1 signalling pathways have emerged as essential in EC biology and in angiogenesis.
Full Name
bone morphogenetic protein 10
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait