Commande rapide

Rhesus BMP-5 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Macaque de Buffon BMP5 Informations sur les produits clonés de cDNA
Taille du ADNc:1365bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) bone morphogenetic protein 5 with C terminal Myc tag.
Synonyme du gène:BMP5
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Bone Morphogenetic Protein 5 (BMP-5) is a member of the structurally and functionally related bone morphogenetic proteins (BMPs) which constitute a novel subfamily of the transforming growth factor β (TGF-β) superfamily. In agreement with a possible role in the control of cell death, BMP-5 exhibited a regulated pattern of expression in the interdigital tissue. Transcripts of BMP-5 and BMP-5 protein were abundant within the cytoplasm of the fragmenting apoptotic interdigital cells in a way suggesting that delivery of BMPs into the tissue is potentiated during apoptosis. Gain-of-function experiments demonstrated that BMP-5 has the same effect as other interdigital BMPs inducing apoptosis in the undifferentiated mesoderm and growth in the prechondrogenic mesenchyme. BMP-5 is a member of the 60A subgroup of BMPs, other members of which have been shown to stimulate dendritic growth in central and peripheral neurons. The signaling pathway that mediates the dendrite-promoting activity of BMP-5 may involve binding to BMPR-IA and activation of Smad-1, and relative levels of BMP antagonists such as noggin and follistatin may modulate BMP-5 signaling. Since BMP-5 is expressed at relatively high levels not only in the developing but also the adult nervous system, these findings suggest the possibility that BMP-5 regulates dendritic morphology not only in the developing, but also the adult nervous system. BMP-5 may play important roles not only in myocardial differentiation, but also in the formation and maintenance of endocardial cushion tissue. Additionally, high expression level of BMP-5 has been detected in certain tumors of mesenchymal origin.

  • Yamagishi T, et al. (2001) Expression of bone morphogenetic protein-5 gene during chick heart development: possible roles in valvuloseptal endocardial cushion formation. Anat Rec. 264(4): 313-6.
  • Beck HN, et al. (2001) Bone morphogenetic protein-5 (BMP-5) promotes dendritic growth in cultured sympathetic neurons. BMC Neurosci. 2:12.
  • Zuzarte-Lus V, et al. (2004) A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways. Dev Biol. 272(1): 39-52.
  • Size / Price
    Catalogue : CG90053-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.