Commande rapide

Rhesus ALK-3 / BMPR1A expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon BMPR1A Informations sur les produits clonés de cDNA
    Taille du ADNc:1599bp
    Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) bone morphogenetic protein receptor, type IA with C terminal Myc tag.
    Synonyme du gène:BMPR1A
    Site de restriction:
    Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Description de la séquence:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name

    Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a type I receptor for bone morphogenetic proteins (BMPs) which belong to the transforming growth factor beta (TGF-β) superfamily. The BMP receptors form a subfamily of transmembrane serine/threonine kinases including the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. ALK-3/BMPR1A is expressed in the epithelium during branching morphogenesis. Deletion of BMPR1A in the epithelium with an Sftpc-cre transgene leads to dramatic defects in lung development. ALK-3 and ALK-6 share a high degree of homology, yet possess distinct signaling roles. The transforming growth factor (TGF)-beta type III receptor (TbetaRIII) enhanced both ALK-3 and ALK-6 signaling. TbetaRIII associated with ALK-3 primarily through their extracellular domains, whereas its interaction with ALK-6 required both the extracellular and cytoplasmic domains. ALK-3 plays an essential role in the formation of embryonic ventral abdominal wall, and abrogation of BMP signaling activity due to gene mutations in its signaling components could be one of the underlying causes of omphalocele at birth. The type IA BMP receptor, ALK-3 was specifically required at mid-gestation for normal development of the trabeculae, compact myocardium, interventricular septum, and endocardial cushion. Cardiac muscle lacking ALK-3 was specifically deficient in expressing TGFbeta2, an established paracrine mediator of cushion morphogenesis. Hence, ALK-3 is essential, beyond just the egg cylinder stage, for myocyte-dependent functions and signals in cardiac organogenesis.

  • Gaussin V, et al. (2002) Endocardial cushion and myocardial defects after cardiac myocyte-specific conditional deletion of the bone morphogenetic protein receptor ALK3. Proc Natl Acad Sci U S A. 99(5): 2878-83.
  • Eblaghie MC, et al. (2006) Evidence that autocrine signaling through Bmpr1a regulates the proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev Biol. 291(1): 67-82.
  • Sun J, et al. (2007) Deficient Alk3-mediated BMP signaling causes prenatal omphalocele-like defect. Biochem Biophys Res Commun. 360(1): 238-43.
  • Lee NY, et al. (2009) The transforming growth factor-beta type III receptor mediates distinct subcellular trafficking and downstream signaling of activin-like kinase (ALK)3 and ALK6 receptors. Mol Biol Cell. 20(20): 4362-70.
  • Size / Price
    Catalogue : CG90064-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.