Commande rapide

Rhesus BMPR2 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus BMPR2 Informations sur les produits clonés de cDNA
Taille du ADNc:3117bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) bone morphogenetic protein receptor, type II (serine/threonine kinase) with C terminal Myc tag.
Synonyme du gène:BMPR2
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

The bone morphogenetic protein type II receptor (BMPR-II, or BMPR2), a receptor for the transforming growth factor (TGF)-beta/bone morphogenetic protein (BMP) superfamily. Reduced expression or function of BMPR2 signaling leads to exaggerated TGF-beta signaling and altered cellular responses to TGF-beta. In endothelial cells, BMPR2 mutation increases the susceptibility of cells to apoptosis. BMPR2 transduces BMP signals by forming heteromeric complexes with and phosphorylating BMP type I receptors. The intracellular domain of BMPR2 is both necessary and sufficient for receptor complex interaction. It had been identified that BMPR2 plays a key role in cell growth. Its mutations lead to hereditary pulmonary hypertension, and knockout of Bmpr-II results in early embryonic lethality. The C-terminal tail of BMPR2 provides binding sites for a number of regulatory proteins that may initiate Smad-independent signalling. BMPR2 mutations were predicted to alter the BMP and TGF-b1/SMAD signalling pathways, resulting in proliferation rather than apoptosis of vascular cells, and greatly increase the risk of developing severe pulmonary arterial hypertension. BMPR2 gene result in familial Primary pulmonary hypertension (PPH) transmitted as an autosomal dominant trait, albeit with low penetrance. Heterozygous germline mutations of BMPR2 gene have been identified in patients with familial and sporadic PPH, indicating that BMPR2 may contribute to the maintenance of normal pulmonary vascular structure and function. Tctex-1, a light chain of the motor complex dynein, interacts with the cytoplasmic domain of BMPR2 and demonstrate that Tctex-1 is phosphorylated by BMPR-II, a function disrupted by PPH disease causing mutations within exon 12. BMPR2 and Tctex-1 co-localize to endothelium and smooth muscle within the media of pulmonary arterioles, key sites of vascular remodelling in PPH.

  • Machado RD, et al. (2003) Functional interaction between BMPR-II and Tctex-1, a light chain of Dynein, is isoform-specific and disrupted by mutations underlying primary pulmonary hypertension. Hum Mol Genet. 12(24): 3277-86.
  • Abramowicz MJ, et al. (2003) Primary pulmonary hypertension after amfepramone (diethylpropion) with BMPR2 mutation. Eur Respir J. 22(3): 560-2.
  • Hassel S, et al. (2004) Proteins associated with type II bone morphogenetic protein receptor (BMPR-II) and identified by two-dimensional gel electrophoresis and mass spectrometry. Proteomics. 4(5): 1346-58.
  • Beppu H, et al. (2005) Generation of a floxed allele of the mouse BMP type II receptor gene. Genesis. 41(3): 133-7.
  • Morrell NW. (2006) Pulmonary hypertension due to BMPR2 mutation: a new paradigm for tissue remodeling? Proc Am Thorac Soc. 3(8): 680-6.
  • Nasim MT, et al. (2008) Stoichiometric imbalance in the receptor complex contributes to dysfunctional BMPR-II mediated signalling in pulmonary arterial hypertension. Hum Mol Genet. 217(11): 1683-94.

    BMPR2 related areas, pathways, and other information

    Size / Price
    Catalogue : CG90065-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.