Commande rapide

Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon BRK1 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:AB172543.1
    Taille du ADNc:228bp
    Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) BRICK1, SCAR>WAVE actin-nucleating complex subunit with C terminal His tag.
    Synonyme du gène:BRK1
    Espèces:Cynomolgus
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90816-ACGCHF270
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90816-ACRCHF270
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90816-ANGCHF270
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90816-ANRCHF270
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90816-CFCHF230
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90816-CHCHF230
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90816-CMCHF230
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90816-CYCHF230
    Macaque de Buffon BRK1/C3orf10 Gène ADNc clone le vecteur de clonageCG90816-GCHF90
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90816-NFCHF230
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90816-NHCHF230
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90816-NMCHF230
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90816-NYCHF230
    Macaque de Buffon BRK1/C3orf10 expression plasmide de Gène l'ADNc ORF cloneCG90816-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : CG90816-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »