After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus CALCOCO1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_005571041.1
Taille du ADNc:2073bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) calcium binding and coiled-coil domain 1 with C terminal Myc tag.
Synonyme du gène:CALCOCO1
Espèces:Cynomolgus
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90426-ACGCHF290
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90426-ACRCHF290
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90426-ANGCHF290
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90426-ANRCHF290
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90426-CFCHF260
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90426-CHCHF260
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90426-CMCHF260
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90426-CYCHF260
Macaque de Buffon CoCoA/CALCOCO1 Gène ADNc clone le vecteur de clonageCG90426-GCHF90
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90426-NFCHF260
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90426-NHCHF260
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90426-NMCHF260
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90426-NYCHF260
Macaque de Buffon CoCoA/CALCOCO1 expression plasmide de Gène l'ADNc ORF cloneCG90426-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90426-CM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »