CD151 cDNA ORF Clone, Cynomolgus, C-Myc tag

Price:
Size:
Number:

CD151 cDNA ORF Clone, Cynomolgus, C-Myc tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
762 bp
Description
Full length Clone DNA of Cynomolgus CD151 molecule (Raph blood group) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD151 Background Information

Tspan8 and CD151 are metastasis-promoting tetraspanins and a knockdown (kd) of Tspan8 or CD151 and most pronounced of both tetraspanins affects the metastatic potential of the rat pancreatic adenocarcinoma line ASML. CD151- and Tspan8-competent tumor exosomes support matrix degradation, reprogram stroma and hematopoietic cells and drive non-metastatic ASML-CD151/Tspan8kd cells towards a motile phenotype. Distinct contributions of CD151 and Tspan8 to skin wound healing rely on preferentially CD151 anchoring basal keratinocytes and Tspan8 promoting motility. Transfection of non-permissive PK-15 cells with porcine CD151 cDNA conferred the susceptibility to PRRSV infection, indicating an important role of the porcine CD151 in PRRSV infection of porcine cells.
Full Name
CD151 molecule (Raph blood group)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait