CD64 cDNA ORF Clone, Rhesus, C-His tag

Price:
Size:
Number:

CD64 cDNA ORF Clone, Rhesus, C-His tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Rhesus high affinity immunoglobulin gamma Fc receptor I with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD64 Background Information

High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membraneglycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of asignal peptidethat allows its transport to the surface of a cell, threeextracellularimmunoglobulin domainsof the C2-type that it uses to bind antibody, a hydrophobictransmembrane domain, and a short cytoplasmic tail. CD64 isconstitutivelyfound on only macrophages and monocytes, but treatment of polymorphonuclear leukocyteswith cytokines likeIFNγandG-CSFcan induce CD64 expression on these cells. The inactivation of the mouse CD64 resulted in a wide range of defects in antibody Fc-dependent functions. Mouse CD64 is an early participant in Fc-dependent cell activation and in the development of immune responses.
Full Name
Fc receptor, IgG, high affinity I
References
  • Allen J.M., et al.,(1988), Nucleotide sequence of three cDNAs for the human high affinity Fc receptor (FcRI). Nucleic Acids Res. 16:11824-11824.
  • Allen J.M., et al., (1989), Isolation and expression of functional high-affinity Fc receptor complementary DNAs.Science 243:378-381.
  • Porges A.J., et al.,(1992), Novel Fc gamma receptor I family gene products in human mononuclear cells.J. Clin. Invest. 90:2102-2109.

CD64 cDNA ORF Clone, Human, Related Products

CD64 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait