Commande rapide

Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus CHN1 Informations sur les produits clonés de cDNA
Taille du ADNc:1005bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chimerin 1 with C terminal HA tag.
Synonyme du gène:CHN1
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90836-ACGCHF270
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90836-ACRCHF270
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90836-ANGCHF270
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90836-ANRCHF270
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90836-CFCHF230
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90836-CHCHF230
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90836-CMCHF230
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90836-CYCHF230
Macaque de Buffon CHN1 / chimerin 1 Gène ADNc clone le vecteur de clonageCG90836-GCHF90
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90836-NFCHF230
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90836-NHCHF230
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90836-NMCHF230
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90836-NYCHF230
Macaque de Buffon CHN1 / chimerin 1 expression plasmide de Gène l'ADNc ORF cloneCG90836-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • Size / Price
    Catalogue : CG90836-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.