CHN1 cDNA ORF Clone, Cynomolgus, untagged

Price:
Size:
Number:

CHN1 cDNA ORF Clone, Cynomolgus, untagged: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Cynomolgus chimerin .
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CHN1 Background Information

CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.
Full Name
chimerin 1
References
  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait