Commande rapide

Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus EEF1B2 Informations sur les produits clonés de cDNA
Taille du ADNc:678bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) eukaryotic translation elongation factor 1 beta 2 with N terminal Flag tag.
Synonyme du gène:EEF1B2
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90457-ACGCHF270
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90457-ACRCHF270
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90457-ANGCHF270
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90457-ANRCHF270
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90457-CFCHF230
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90457-CHCHF230
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90457-CMCHF230
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90457-CYCHF230
Macaque de Buffon EF1B / EEF1B2 Gène ADNc clone le vecteur de clonageCG90457-GCHF90
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90457-NFCHF230
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90457-NHCHF230
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90457-NMCHF230
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90457-NYCHF230
Macaque de Buffon EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF cloneCG90457-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Catalogue : CG90457-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.