Commande rapide

Text Size:AAA

Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus ENO1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001195611.1
Taille du ADNc:1305bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
Synonyme du gène:ENO1
Espèces:Rhesus
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90355-ACGCHF270
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90355-ACRCHF270
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90355-ANGCHF270
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90355-ANRCHF270
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90355-CFCHF230
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90355-CHCHF230
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90355-CMCHF230
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90355-CYCHF230
Rhesus ENO1 / Enolase 1 / alpha-enolase Gène ADNc clone le vecteur de clonageCG90355-GCHF90
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90355-NFCHF230
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90355-NHCHF230
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90355-NMCHF230
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90355-NYCHF230
Rhesus ENO1 / Enolase 1 / alpha-enolase expression plasmide de Gène l'ADNc ORF cloneCG90355-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Références
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Catalogue : CG90355-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »