FABP3 cDNA ORF Clone, Cynomolgus, N-Myc tag

Price:
Size:
Number:

FABP3 cDNA ORF Clone, Cynomolgus, N-Myc tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
402 bp
Description
Full length Clone DNA of Cynomolgus fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FABP3 Background Information

Fatty acid binding protein 3 (FABP3, also termed heart-type fatty acid binding protein) is a member of the intracellular lipid-binding protein family that may be essential in fatty acid transport, cell growth, cellular signaling and gene transcription. Previously FABP3 was involved in apoptosis-associated congenital cardiac malformations. FABP3 knockdown exhibited significant toxic effects on cardiac development and mitochondrial function, which may be responsible for the knockdown of FABP3-induced apoptosis. FABP3 as a candidate gene underlying the etiology of congenital heart defects. Overexpression of FABP3 inhibited cell growth and proliferation via negative regulation of the cell cycle and down-regulation of cell growth factors, but enhances cell survival in hypoxic or ischemic conditions. FABPs are known to be carrier proteins for transporting fatty acids and other lipophilic substances from the cytoplasm to the nucleus, where these lipids are released to a group of nuclear receptors such as peroxisome proliferator-activated receptors (PPARs).
Full Name
fatty acid binding protein 3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait