After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus FAH Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_005560246.1
Taille du ADNc:1260bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) fumarylacetoacetate hydrolase (fumarylacetoacetase).
Synonyme du gène:FAH
Espèces:Cynomolgus
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone on other vectors
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90717-ACGCHF270
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90717-ACRCHF270
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90717-ANGCHF270
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90717-ANRCHF270
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90717-CFCHF230
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90717-CHCHF230
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90717-CMCHF230
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90717-CYCHF230
Macaque de Buffon fumarylacetoacetate hydrolase Gène ADNc clone le vecteur de clonageCG90717-GCHF90
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90717-NFCHF230
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90717-NHCHF230
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90717-NMCHF230
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90717-NYCHF230
Macaque de Buffon fumarylacetoacetate hydrolase expression plasmide de Gène l'ADNc ORF cloneCG90717-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90717-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »