FGF12 cDNA ORF Clone, Rhesus, C-HA tag

Price:
Size:
Number:

FGF12 cDNA ORF Clone, Rhesus, C-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Rhesus fibroblast growth factor 12 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGF12 Background Information

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.
Full Name
fibroblast growth factor 12
References
  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait