FGF14 cDNA ORF Clone, Rhesus, N-HA tag

Price:
Size:
Number:

FGF14 cDNA ORF Clone, Rhesus, N-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Rhesus fibroblast growth factor 14 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGF14 Background Information

FGF14 is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF14 is probably involved in nervous system development and function. Defects in FGF14 are the cause of spinocerebellar ataxia type 27 (SCA27). It is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA27 is an autosomal dominant cerebellar ataxia. It is a slowly progressive disorder, with onset in late-childhood to early adulthood, characterized by ataxia with tremor, orofacial dyskinesia, psychiatric symptoms and cognitive deficits.
Full Name
fibroblast growth factor 14
References
  • Wang Q, et al. (2002) Ataxia and paroxysmal dyskinesia in mice lacking axonally transported FGF14. Neuron. 35 (1): 25-38.
  • Zhao Y, et al. (2007) Genetic analysis of SCA 27 in ataxia and childhood onset postural tremor. Am J Med Genet. 144B (3): 395-6.
  • Lou JY, et al. (2005) Fibroblast growth factor 14 is an intracellular modulator of voltage-gated sodium channels. J Physiol. 569 (1): 179-93.

FGF14 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait