FGF16 cDNA ORF Clone, Rhesus, C-HA tag

Price:
Size:
Number:

FGF16 cDNA ORF Clone, Rhesus, C-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Rhesus fibroblast growth factor 16 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGF16 Background Information

Fibroblast growth factor 16 (FGF16) is preferentially expressed in the heart after birth, suggesting its regulation is associated with tissue-specific chromatin remodeling and DNA-protein interactions. Mutation of the MEF2 site resulted in a blunting of FGF16 promoter activity in transfected neonatal rat cardiac myocytes, that chromatin remodeling and MEF2 binding in the FGF16 promoter contribute to expression in the postnatal heart. FGF16 involvement in the fine tuning of the human skeleton of the hand. Impaired FGF16 function may also be responsible for connective tissue symptoms in MF4 patients. FGF16 expression is markedly increased in ovarian tumors, and FGF16 in conjunction with Wnt pathway contributes to the cancer phenotype of ovarian cells and suggests that modulation of its expression in ovarian cells might be a promising therapeutic strategy for the treatment of invasive ovarian cancers.
Full Name
fibroblast growth factor 16
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait