KGF cDNA ORF Clone, Rhesus, C-HA tag

Price:
Size:
Number:

KGF cDNA ORF Clone, Rhesus, C-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Rhesus fibroblast growth factor 7 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KGF Background Information

Fibroblast growth factor 7 (FGF7) is a member of the fibroblast growth factor (FGF) family of proteins. FGF7 plays an important role in regulating the proliferation, migration, and differentiation of cells. FGF7 is of stromal origin and produces a paracrine effect on epithelial cells. FGF7 is a mesenchyme-specific heparin-binding growth factor that binds FGF receptor 2 (FGFR2) to regulate numerous cellular and physiological processes. FGF7/FGFR2 promotes invasion and migration in human gastric cancer. FGF7 is specifically utilized as a paracrine factor during the process of differentiation of the epidermal layers in the regenerating scales and in particular for beta-cells differentiation. FGF7 over expression is associated with advanced clinical features in patients with upper tract and bladder urothelial carcinoma, justifying its potential prognostic value for urothelial carcinoma.
Full Name
fibroblast growth factor 7
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait