After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rhesus FRZB / sFRP-3 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus FRZB Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001257416.2
Taille du ADNc:978bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) frizzled-related protein with N terminal HA tag.
Synonyme du gène:FRZB
Espèces:Rhesus
Vecteur:pCMV3-SP-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

FRZB also known as sFRP-3, is a secreted protein containing a domain similar to the putative Wnt-binding region of the frizzled family of transmembrane receptors. FRZB is widely expressed in adult mammalian tissues. In the Xenopus gastrula, FRZB is regulated as a typical Spemann organizer component. FRZB also functions as a competitor for the cell-surface G-protein receptor Frizzled. It is espically important in embryonic development. Defects in FRZB gene can cause female-specific osteoarthritis (OA) susceptibility. FRZB may serve an important role in determining hip shape and may modify the relationship between hip shape and OA.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »