After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rhesus GDF15/MIC-1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus GDF15 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_001114375.2
Taille du ADNc:927bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) growth differentiation factor 15 with C terminal Myc tag.
Synonyme du gène:GDF15
Espèces:Rhesus
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Growth-differentiation factor 15 (GDF15), also known as MIC-1, is a secreted member of the transforming growth factor (TGF)-β superfamily, as a novel antihypertrophic regulatory factor in the heart. GDF-15 / GDF15 is not expressed in the normal adult heart but is induced in response to conditions that promote hypertrophy and dilated cardiomyopathy and it is expressed highly in liver. GDF-15 / GDF15 has a role in regulating inflammatory and apoptotic pathways in injured tissues and during disease processes. GDF-15 / GDF15 is synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein. GDF-15 / GDF15 overexpression arising from an expanded erythroid compartment contributes to iron overload in thalassemia syndromes by inhibiting hepcidin expression.

Références
  • Ago T, et al. (2006) GDF15, a cardioprotective TGF-beta superfamily protein. Circ Res. 98 (3): 294-297.
  • Hsiao E, et al. (2000) Characterization of growth-differentiation factor 15, a transforming growth factor beta superfamily member induced following liver injury. Mol Cell Biol. 20 (10): 3742-51.
  • Zimmers T, et al. (2005) Growth differentiation factor-15/macrophage inhibitory cytokine-1 induction after kidney and lung injury. Shock. 23 (6): 543-8.
  • Size / Price
    Catalogue : CG90069-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »