After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rhesus GGCT expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus GGCT Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001266969.1
Taille du ADNc:567bp
Description du ADNc:Full length Clone DNA of Macaca mulatta (Rhesus monkey) gamma-glutamylcyclotransferase with N terminal His tag.
Synonyme du gène:GGCT
Espèces:Rhesus
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

GGCT belongs to the gamma-glutamylcyclotransferase family. It catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism. GGCT may play a significant role in glutathione homeostasis. GGCT also induces release of cytochrome c from mitochondria with resultant induction of apoptosis. Pseudogenes of GGCT gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Références
  • Wagner SA. et al., 2011, Mol Cell Proteomics. 10 (10): M111.013284.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Amano T. et al., 2012, J Histochem Cytochem. 60 (1): 76-86.
  • Size / Price
    Catalogue : CG90618-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »