After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus GOT1 Informations sur les produits clonés de cDNA
Taille du ADNc:1242bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Aspartate aminotransferase, cytoplasmic with N terminal Myc tag.
Synonyme du gène:cCAT, cAspAT
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90649-ACGCHF270
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90649-ACRCHF270
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90649-ANGCHF270
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90649-ANRCHF270
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90649-CFCHF230
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90649-CHCHF230
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90649-CMCHF230
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90649-CYCHF230
Macaque de Buffon Aspartate aminotransferase / GOT1 Gène ADNc clone le vecteur de clonageCG90649-GCHF90
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90649-NFCHF230
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90649-NHCHF230
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90649-NMCHF230
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90649-NYCHF230
Macaque de Buffon Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF cloneCG90649-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catalogue : CG90649-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.