IFNGR1 cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90207-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IFNGR1 Reagents

CRO Services

Product recommended


All IFNGR1 Reagents

IFNGR1 cDNA ORF Clone, Rhesus, C-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1467 bp
Description
Full length Clone DNA of Rhesus interferon gamma receptor 1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFNGR1 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD119 (cluster of differentiation 119), also known as IFNGR1 ( interferon gamma receptor 1), is part of the heterodimeric gamma interferon receptor which consists of IFNGR1 (CD119) and IFNGR2. The IFNGR1 gene encodes the ligand-binding chain (alpha) of the interteron receptor while IFNGR gene encodes the non-ligand binding partner. The ability of the interferon-γ was achieved through binding to the interferon receptor CD119. After binding, the products of activated T-lymphocytes interferon-γ exerts antiviral activity, growth inhibitory effect, and several immune- regulatory activities on a variety of cell types.
Full Name
interferon gamma receptor 1
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Novick D, et al. (1987) The human interferon-gamma receptor. The journal of biological chemistry. 262 (18): 8483-7
  • IFNGR1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IFNGR1 cDNA ORF Clone in Cloning Vector, Rhesus CG90207-G
    IFNGR1 cDNA ORF Clone, Rhesus, untagged CG90207-UT
    IFNGR1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90207-ACG
    IFNGR1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90207-ACGLN
    IFNGR1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90207-ACR
    IFNGR1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90207-CF
    IFNGR1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90207-NF
    IFNGR1 cDNA ORF Clone, Rhesus, C-His tag CG90207-CH
    IFNGR1 cDNA ORF Clone, Rhesus, N-His tag CG90207-NH
    IFNGR1 cDNA ORF Clone, Rhesus, N-HA tag CG90207-NY
    IFNGR1 cDNA ORF Clone, Rhesus, C-Myc tag CG90207-CM
    IFNGR1 cDNA ORF Clone, Rhesus, N-Myc tag CG90207-NM

    IFNGR1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IFNGR1 cDNA ORF Clone in Cloning Vector, Rat RG80328-G
    IFNGR1 cDNA ORF Clone, Rat, untagged RG80328-UT
    IFNGR1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80328-ACG
    IFNGR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80328-ACGLN
    IFNGR1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80328-ACR
    IFNGR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80328-CF
    IFNGR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80328-NF
    IFNGR1 cDNA ORF Clone, Rat, C-His tag RG80328-CH
    IFNGR1 cDNA ORF Clone, Rat, N-His tag RG80328-NH
    IFNGR1 cDNA ORF Clone, Rat, C-HA tag RG80328-CY
    IFNGR1 cDNA ORF Clone, Rat, N-HA tag RG80328-NY
    IFNGR1 cDNA ORF Clone, Rat, C-Myc tag RG80328-CM
    IFNGR1 cDNA ORF Clone, Rat, N-Myc tag RG80328-NM
    IFNGR1 qPCR Primer Pairs, Rat RP300299

    IFNGR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IFNGR1 cDNA ORF Clone in Cloning Vector, Mouse MG50705-M
    IFNGR1 cDNA ORF Clone, Mouse, untagged MG50705-UT
    IFNGR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50705-ACGLN
    IFNGR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50705-ACG
    IFNGR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50705-ACR
    IFNGR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50705-CF
    IFNGR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50705-NF
    IFNGR1 cDNA ORF Clone, Mouse, C-His tag MG50705-CH
    IFNGR1 cDNA ORF Clone, Mouse, N-His tag MG50705-NH
    IFNGR1 cDNA ORF Clone, Mouse, C-HA tag MG50705-CY
    IFNGR1 cDNA ORF Clone, Mouse, N-HA tag MG50705-NY
    IFNGR1 cDNA ORF Clone, Mouse, C-Myc tag MG50705-CM
    IFNGR1 cDNA ORF Clone, Mouse, N-Myc tag MG50705-NM
    IFNGR1 qPCR Primer Pairs, Mouse MP200680

    IFNGR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IFNGR1 cDNA ORF Clone in Cloning Vector, Human HG10338-M
    IFNGR1 cDNA ORF Clone, Human, untagged HG10338-UT
    IFNGR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10338-ACG
    IFNGR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10338-ACGLN
    IFNGR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10338-ACR
    IFNGR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10338-CF
    IFNGR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10338-NF
    IFNGR1 cDNA ORF Clone, Human, C-His tag HG10338-CH
    IFNGR1 cDNA ORF Clone, Human, N-His tag HG10338-NH
    IFNGR1 cDNA ORF Clone, Human, C-HA tag HG10338-CY
    IFNGR1 cDNA ORF Clone, Human, N-HA tag HG10338-NY
    IFNGR1 cDNA ORF Clone, Human, C-Myc tag HG10338-CM
    IFNGR1 cDNA ORF Clone, Human, N-Myc tag HG10338-NM
    IFNGR1 qPCR Primer Pairs, Human HP100377
    info info
    添加购物车成功! 添加购物车失败!