After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Macaque de Buffon IGSF8 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus IGSF8 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_005541281.1
Taille du ADNc:1845bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) immunoglobulin superfamily, member 8.
Synonyme du gène:IGSF8
Espèces:Cynomolgus
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Références
  • Glazar AI, et al. (2009) Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: evidence of distinct functions for CD9 and a CD9-associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 21(2): 293-303.
  • Murdoch JN, et al. (2003) Genomic organization and embryonic expression of Igsf8, an immunoglobulin superfamily member implicated in development of the nervous system and organ epithelia. Mol Cell Neurosci. 22(1): 62-74.
  • Zhang XA, et al. (2003) EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63 (10): 2665-74.
  • Size / Price
    Catalogue : CG90732-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »