Galectin 3 / LGALS3 cDNA ORF Clone, Rhesus, untagged

Price:
Size:
Number:

Galectin 3 / LGALS3 cDNA ORF Clone, Rhesus, untagged: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
747 bp
Description
Full length Clone DNA of Rhesus lectin, galactoside-binding, soluble, 3.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Galectin 3 / LGALS3 Background Information

LGALS3, a member of the lectin family, has an important role in tumor progression through inhibition of apoptosis.The galectin-3 gene (LGALS3) encodes a beta-galactose binding lectin. LGALS3 expression is associated with neoplastic transformation and with differentiation of monocytes to macrophages. Galectin-3 is a beta-galactoside-binding lectin which is involved in modulating inflammation and apoptosis. Elevated expression of galectin-3 has been demonstrated in synovium of rheumatoid arthritis (RA).
Full Name
lectin, galactoside-binding, soluble, 3
References
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait