After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus LOC101865541 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_005568574.1
Taille du ADNc:816bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865541.
Synonyme du gène:LOC101865541
Espèces:Cynomolgus
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone on other vectors
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90737-ACGCHF270
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90737-ACRCHF270
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90737-ANGCHF270
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90737-ANRCHF270
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90737-CFCHF230
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90737-CHCHF230
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90737-CMCHF230
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90737-CYCHF230
Macaque de Buffon LOC101865541 Gène ADNc clone le vecteur de clonageCG90737-GCHF90
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90737-NFCHF230
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90737-NHCHF230
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90737-NMCHF230
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90737-NYCHF230
Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF cloneCG90737-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90737-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »