Commande rapide

Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon LOC101865541 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:XM_005568574.1
    Taille du ADNc:816bp
    Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865541.
    Synonyme du gène:LOC101865541
    Espèces:Cynomolgus
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone on other vectors
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90737-ACGCHF390
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90737-ACRCHF390
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90737-ANGCHF390
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90737-ANRCHF390
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90737-CFCHF350
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90737-CHCHF350
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90737-CMCHF350
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90737-CYCHF350
    Macaque de Buffon LOC101865541 Gène ADNc clone le vecteur de clonageCG90737-GCHF90
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90737-NFCHF350
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90737-NHCHF350
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90737-NMCHF350
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90737-NYCHF350
    Macaque de Buffon LOC101865541 expression plasmide de Gène l'ADNc ORF cloneCG90737-UTCHF350
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »