Commande rapide

Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus LOC101865604 Informations sur les produits clonés de cDNA
Taille du ADNc:300bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865604 with N terminal His tag.
Synonyme du gène:LOC101865604
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90593-ACGCHF270
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90593-ACRCHF270
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90593-ANGCHF270
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90593-ANRCHF270
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90593-CFCHF230
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90593-CHCHF230
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90593-CMCHF230
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90593-CYCHF230
Macaque de Buffon LOC101865604 Gène ADNc clone le vecteur de clonageCG90593-GCHF90
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90593-NFCHF230
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90593-NHCHF230
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90593-NMCHF230
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90593-NYCHF230
Macaque de Buffon LOC101865604 expression plasmide de Gène l'ADNc ORF cloneCG90593-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90593-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.