Commande rapide

Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon LOC101865643 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:XM_005574721.1
    Taille du ADNc:630bp
    Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) hypothetical protein.
    Synonyme du gène:LOC101865643
    Espèces:Cynomolgus
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone on other vectors
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90750-ACGCHF390
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90750-ACRCHF390
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90750-ANGCHF390
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90750-ANRCHF390
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90750-CFCHF350
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90750-CHCHF350
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90750-CMCHF350
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90750-CYCHF350
    Macaque de Buffon LOC101865643 Gène ADNc clone le vecteur de clonageCG90750-GCHF90
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90750-NFCHF350
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90750-NHCHF350
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90750-NMCHF350
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90750-NYCHF350
    Macaque de Buffon LOC101865643 expression plasmide de Gène l'ADNc ORF cloneCG90750-UTCHF350
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : CG90750-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »