Commande rapide

Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Macaque de Buffon LOC101865855 Informations sur les produits clonés de cDNA
Taille du ADNc:240bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865855 with C terminal His tag.
Synonyme du gène:LOC101865855
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90829-ACGCHF390
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90829-ACRCHF390
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90829-ANGCHF390
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90829-ANRCHF390
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90829-CFCHF350
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90829-CHCHF350
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90829-CMCHF350
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90829-CYCHF350
Macaque de Buffon LOC101865855 Gène ADNc clone le vecteur de clonageCG90829-GCHF90
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90829-NFCHF350
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90829-NHCHF350
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90829-NMCHF350
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90829-NYCHF350
Macaque de Buffon LOC101865855 expression plasmide de Gène l'ADNc ORF cloneCG90829-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90829-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Ajouter au panierBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.