Commande rapide

Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon LOC101866811 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_001283502.1
    Taille du ADNc:1113bp
    Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866811 with N terminal His tag.
    Synonyme du gène:LOC101866811
    Espèces:Cynomolgus
    Vecteur:pCMV3-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90595-ACGCHF390
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90595-ACRCHF390
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90595-ANGCHF390
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90595-ANRCHF390
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90595-CFCHF350
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90595-CHCHF350
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90595-CMCHF350
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90595-CYCHF350
    Macaque de Buffon LOC101866811 Gène ADNc clone le vecteur de clonageCG90595-GCHF90
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90595-NFCHF350
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90595-NHCHF350
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90595-NMCHF350
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90595-NYCHF350
    Macaque de Buffon LOC101866811 expression plasmide de Gène l'ADNc ORF cloneCG90595-UTCHF350
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : CG90595-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »