Commande rapide

Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus LOC101866917 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001284688.1
Taille du ADNc:1413bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866917 with N terminal His tag.
Synonyme du gène:LOC101866917
Espèces:Cynomolgus
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90596-ACGCHF270
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90596-ACRCHF270
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90596-ANGCHF270
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90596-ANRCHF270
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90596-CFCHF230
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90596-CHCHF230
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90596-CMCHF230
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90596-CYCHF230
Macaque de Buffon LOC101866917 Gène ADNc clone le vecteur de clonageCG90596-GCHF90
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90596-NFCHF230
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90596-NHCHF230
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90596-NMCHF230
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90596-NYCHF230
Macaque de Buffon LOC101866917 expression plasmide de Gène l'ADNc ORF cloneCG90596-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90596-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »