ARIH2 cDNA ORF Clone, Cynomolgus, untagged

Price:
Size:
Number:

ARIH2 cDNA ORF Clone, Cynomolgus, untagged: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
261 bp
Description
Full length Clone DNA of Cynomolgus uncharacterized LOC10186716.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ARIH2 Background Information

 ARIH2 encodes the Triad1 protein, an anti-proliferative E3 ubiquitin ligase. In the current study, we investigate the role of Triad1 in leukemogenesis induced by an MLL1 fusion protein (Mll-Ell). we investigate the role of Triad1 in leukemogenesis induced by an MLL1 fusion protein (Mll-Ell), relevant Triad1 substrates may indicate novel therapeutic targets in this disease. E3 ligase, Ariadne homolog 2 (ARIH2), as a posttranslational negative regulator of NLRP3 inflammasome activity in macrophages. ARIH2 interacted with NLRP3 via its NACHT domain (aa 22-575) in the NLRP3 inflammasome complex. ARIH2 overexpression promoted NLRP3 ubiquitination and inhibited NLRP3 inflammasome activation. Reveal a novel mechanism of ubiquitination-dependent negative regulation of the NLRP3 inflammasome by ARIH2 and highlight ARIH2 as a potential therapeutic target for inflammatory diseases.
Full Name
ariadne RBR E3 ubiquitin protein ligase 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait