Commande rapide

Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Macaque de Buffon LOC101926584 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001284849.1
Taille du ADNc:447bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101926584.
Synonyme du gène:LOC101926584
Espèces:Cynomolgus
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone on other vectors
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90730-ACGCHF390
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90730-ACRCHF390
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90730-ANGCHF390
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90730-ANRCHF390
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90730-CFCHF350
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90730-CHCHF350
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90730-CMCHF350
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90730-CYCHF350
Macaque de Buffon LOC101926584 Gène ADNc clone le vecteur de clonageCG90730-GCHF90
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90730-NFCHF350
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90730-NHCHF350
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90730-NMCHF350
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90730-NYCHF350
Macaque de Buffon LOC101926584 expression plasmide de Gène l'ADNc ORF cloneCG90730-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90730-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »