Commande rapide

Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus LOC101926831 Informations sur les produits clonés de cDNA
Taille du ADNc:1179bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101926831 with C terminal His tag.
Synonyme du gène:LOC101926831
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90835-ACGCHF270
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90835-ACRCHF270
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90835-ANGCHF270
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90835-ANRCHF270
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90835-CFCHF230
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90835-CHCHF230
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90835-CMCHF230
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90835-CYCHF230
Macaque de Buffon LOC101926831 Gène ADNc clone le vecteur de clonageCG90835-GCHF90
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90835-NFCHF230
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90835-NHCHF230
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90835-NMCHF230
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90835-NYCHF230
Macaque de Buffon LOC101926831 expression plasmide de Gène l'ADNc ORF cloneCG90835-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90835-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.