Commande rapide

Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon MSRA Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:XM_005562601.1
    Taille du ADNc:579bp
    Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) methionine sulfoxide reductase A with C terminal Myc tag.
    Synonyme du gène:MSRA
    Espèces:Cynomolgus
    Vecteur:pCMV3-C-Myc
    Plasmid:
    Site de restriction:
    Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90429-ACGCHF270
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90429-ACRCHF270
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90429-ANGCHF270
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90429-ANRCHF270
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90429-CFCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90429-CHCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90429-CMCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90429-CYCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A Gène ADNc clone le vecteur de clonageCG90429-GCHF90
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90429-NFCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90429-NHCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90429-NMCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90429-NYCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF cloneCG90429-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : CG90429-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »