After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Cynomolgus MSRA Informations sur les produits clonés de cDNA
Gene_bank_ref_id:XM_005562601.1
Taille du ADNc:579bp
Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) methionine sulfoxide reductase A with N terminal HA tag.
Synonyme du gène:MSRA
Espèces:Cynomolgus
Vecteur:pCMV3-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90429-ACGCHF270
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90429-ACRCHF270
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90429-ANGCHF270
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90429-ANRCHF270
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90429-CFCHF230
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90429-CHCHF230
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90429-CMCHF230
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90429-CYCHF230
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A Gène ADNc clone le vecteur de clonageCG90429-GCHF90
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90429-NFCHF230
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90429-NHCHF230
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90429-NMCHF230
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90429-NYCHF230
Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF cloneCG90429-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : CG90429-NY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »