Commande rapide

Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Macaque de Buffon MSRA Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:XM_005562601.1
    Taille du ADNc:579bp
    Description du ADNc:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) methionine sulfoxide reductase A with N terminal HA tag.
    Synonyme du gène:MSRA
    Espèces:Cynomolgus
    Vecteur:pCMV3-N-HA
    Plasmid:
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurCG90429-ACGCHF270
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurCG90429-ACRCHF270
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurCG90429-ANGCHF270
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurCG90429-ANRCHF270
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurCG90429-CFCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurCG90429-CHCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurCG90429-CMCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurCG90429-CYCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A Gène ADNc clone le vecteur de clonageCG90429-GCHF90
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurCG90429-NFCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurCG90429-NHCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurCG90429-NMCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurCG90429-NYCHF230
    Macaque de Buffon MSRA/Methionine Mulfoxide Reductase A expression plasmide de Gène l'ADNc ORF cloneCG90429-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : CG90429-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »