Alpha SNAP cDNA ORF Clone, Rhesus, untagged

Price:
Size:
Number:

Alpha SNAP cDNA ORF Clone, Rhesus, untagged: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Rhesus N-ethylmaleimide-sensitive factor attachment protein, alph.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Alpha SNAP Background Information

NAPA represents an anti-apoptotic protein that promotes resistance to cisplatin in cancer cells by inducing the degradation of the tumor suppressor p53. Knockdown of NAPA using short-hairpin RNA was shown to induce p53 accumulation and to sensitize HEK293 cells to cisplatin. NAPA overexpression decreased the ubiquitination and degradation of synoviolin, and reduced p53 protein level.The combination of cisplatin and knockdown of NAPA represents a novel and attractive strategy to eradicate p53-sensitive cancer cells.NAPA-73 as one of the earliest neuronal markers may reflect a difference between the central and peripheral nervous systems.
Full Name
N-ethylmaleimide-sensitive factor attachment protein, alpha
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait